24/7 Study Help

Studykind Will Help You Write Your Essays and Term Papers

From initial topic to finished paper

Want answers to the assignment Below? 

For premier support Text or Whatsapp Ivanna at +1(478) 377-7377 

Question: 2. The schematic below shows the first 63 bp of the GFP ORF as double-stranded DNA 2a. Write out…

2. The schematic below shows the first 63 bp of
the GFP ORF as double-stranded DNA

Question: 2. The schematic below shows the first 63 bp ofthe GFP ORF as double-stranded DNA2a. Write out...

2a. Write out the 21 nucleotides of mRNA
sequence that correspond to the beginning of the open reading
frame. Indicate the polarity (5’, 3’) of your mRNA sequence. [4
pts

2b. Write out the sequence of amino acids that
would be encoded by the 21 nucleotide mRNA (described in 2a) during
translation. Indicate the N terminus and C terminus of your
protein. [4 pts]

2c. Describe a single nucleotide change in DNA
that could result in a nonsense mutation within this 21 nucleotide
region. Include the number and nucleotide of the mutation (Example:
A+1G). Explain your answer. [4 pts]

10 20 30 40 50 60 5 ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGAT 3′ TACTCATTTCCTCTTCTTGAAAAGTGACCTCAACAGGGTTAAGAACAACTTAATCTACCACTA

Essay Writing Service Ready to Help Online 24/7

Hire a professional just from $9.99

Click here

HOME TO CERTIFIED WRITERS

Why Place An Order With Us?

  • Certified Editors
  • 24/7 Customer Support
  • Profesional Research
  • Easy to Use System Interface
  • Student Friendly Pricing

Have a similar question?

Need a previously written solution for this question?

Services that we offer

Your Paper Is In Safe Hands

PLAGIRAISM FREE PAPERS

All papers we provide are well-researched, properly formatted and cited.

TOP QUALITY

All papers we provide are well-researched, properly formatted and cited.

HIGHLY SECURED

All papers we provide are well-researched, properly formatted and cited.

Related Assignments

Study more efficiently

Quickly get your essay from idea to final graft save time, money and effort.

Boost your grade

Get through your toughest problem and learn how to solve them from expert writers

Get on board with the best writers.

“All our writers are certified professionals, holding Masters Degrees and above.”

Our company has worked successfully in the field of academic assistance for over 11 years. We consistently upgrade our goals to improve the quality of service we provide and to maximize customer satisfaction. Success has driven us forward to an innovative concept. Our working experience, customer feedback, and market resources have brought about the creation of an exclusive online service:

Chat now
Powered by Studykind
Hello! Welcome to to our whatapp support.

We offer READY solutions, HIGH QUALITY PLAGIARISM FREE essays and term-papers.

We are online and ready to help.