Design 18 bp PCR primers to amplify (and detect!) the following
portion of thecauliflower mosaic virus 35S promoter:
gtagtgggattgtgcgtcatcccttacgtcagtgg(110bases)tcaacgatggcctttcctttatcgcaatgatggcatttgtaggagc
From initial topic to finished paper
Design 18 bp PCR primers to amplify (and detect!) the following
portion of thecauliflower mosaic virus 35S promoter:
gtagtgggattgtgcgtcatcccttacgtcagtgg(110bases)tcaacgatggcctttcctttatcgcaatgatggcatttgtaggagc
Description Paper question info: Think of a company with which you are familiar. Describe the company and their primary product(s)/service(s)....
1. The purpose or mission statement from the DNP student. (What they want to discover working on their DNP project). (Cognitive therapy against...
this Assignment, you will write an advocacy letter to public official about a problem and a policy In addition, you will write a 2 page...
Quickly get your essay from idea to final graft save time, money and effort.
Get through your toughest problem and learn how to solve them from expert writers
“All our writers are certified professionals, holding Masters Degrees and above.”
Our company has worked successfully in the field of academic assistance for over 11 years. We consistently upgrade our goals to improve the quality of service we provide and to maximize customer satisfaction. Success has driven us forward to an innovative concept. Our working experience, customer feedback, and market resources have brought about the creation of an exclusive online service: