From initial topic to finished paper
The following is a sequence of DNA: both the top and bottom strands are shown. During transcription the top strand is the coding strand. Indicate the direction of transcription – aka which way would RNA polymerase move? 5′ – ATGTTTGAGTGATGTAACCCTACGTCAGTACCGTA – 3′ 3′ – TACAAACTCACTACATTGGGATGCAGTCATGGCAT – 5′ left to right? right to left?
Your Paper Is In Safe Hands
PLAGIRAISM FREE PAPERS
All papers we provide are well-researched, properly formatted and cited.
TOP QUALITY
All papers we provide are well-researched, properly formatted and cited.
HIGHLY SECURED
All papers we provide are well-researched, properly formatted and cited.
The death of an elderly individual may occur in a variety of settings and circumstances. For example, an individual may die painlessly at home...
Go to the Kean University website and explore the following sections by searching for each in the search bar:Academic Integrity Policy Student...
Assignment Details Question 1: Suppose a severe drought hits the sugarcane crop. Using a supply and demand model explain how this will affect the...
Quickly get your essay from idea to final graft save time, money and effort.
Get through your toughest problem and learn how to solve them from expert writers
“All our writers are certified professionals, holding Masters Degrees and above.”
Our company has worked successfully in the field of academic assistance for over 11 years. We consistently upgrade our goals to improve the quality of service we provide and to maximize customer satisfaction. Success has driven us forward to an innovative concept. Our working experience, customer feedback, and market resources have brought about the creation of an exclusive online service:
